I have just returned from British Columbia in Canada. I have to admit that their license plate motto is quite accurate: BC is incredibly beautiful. Another thing that struck me is the provincial flag of BC: the Union Jack at the top (OK, it is British Columbia), there are white and blue horizontal stripes, and […]
Displaying the most recent of 472 posts written by
Iddo
No apologies to Lady Gaga necessary.
So here are EssOh and OhOne assembling a rather frustrating puzzle containing cows. The same 5-6 cow “characters” are repeated, which is a perfect way to illustrate low-complexity DNA sequences, and why they are hard to assemble, especially when the pieces are small, like those you get from some second generation sequencers.
I received this from a colleague today. The sender’s name and identifying information have been removed to protect the guilty. Under the United States Constitution Article I, Section 8, Clause 4 as enacted in Title 11 USC Chapter 7, individuals may declare personal bankruptcy when their debts cannot be satisfied. You are hereby notified that […]
Some time ago an article in Linux Journal discussed the adoption of free/open course software (FOSS) by the general public. The article (I can’t seem to find it now) talked about the people that do not care about the distinction between Free as in Free Beer vs. Free as in Freedom (libre). They want software […]
The Genome Center at University of California Davis and researchers at UC Santa Cruz are organizing a genome assembly competition which they call The Assemblathon. They have released two simulated genomes for competing groups to assemble as best they can. Assemblies are due February 6th, 2011. So there is still time, if you would like […]
Two of my favorite films were directed by Peter Yates, who died yesterday at the age of 82. Bullit which features a great car chase scene through the streets of San Francisco. A 1968 Mustang GT 390 Fastback driven by Steve McQueen, playing Lieutenant Frank Bullitt. Bullitt chased a black Dodge Charger R/T driven by suspected […]
Open Lab is a collection of the crème-de-la-crème of the science blog posts over each year. Meticulously edited, only the finest of posts make it. Out of nearly 900 submissions this year, 50 (plus six poems and one cartoon) were carefully selected. Truly an amazing achievement of Bora Zivkovic, and especially his co-editor this year, […]
The PhD Challenge asks graduate students to do their utmost in their submitted papers. You thought getting a paper accepted is hard? Try getting a paper accepted which contains the sentence “I smoke crack rocks”. That was the PhD challenge for 2010, and Gabriel Parent from Carnegie Mellon University has lived up to it with […]
catgaacgcgaataagcgcgcgaataaagcatggaataaaacatttgcgaataatttattcgcgaatggcgcaaaagc
One of the more bizarre outcomes of the series. They had me with the keyboard player dressed like Tom Baker with a mustache.
Nature Genetics seems to have taken a page from the Food Network Magazine by timing two publications to the annual obsession with festive foods among many, NG readership included. I am talking about the genomes of the Strawberry and of the Cocoa plants. Both are important crops, both are components of luxurious eating. Both papers are comprehensive […]
The personal genomics company 23&me is hosting a poetry contest. The winner receives a free pass to the Personalized World Medicine Conference. Poems should include a bunch of keywords having to do with 23&me, personalized genomics and all that jazz. I’m no poet (and don’t you know it), so here is my Haiku non-entry: My genome was seq- […]
Winter Solstice Lunar Eclipse from William Castleman on Vimeo. Time lapse video of Winter Solstice Lunar Eclipse on December 21, 2010 from 1:10 AM EST (6:10 GMT) to 5:03 AM EST (10:03 GMT) from Gainesville Florida. Music is Claude Debussy Nocturnes: Sirènes.
If you are a teacher / instructor in the broadest sense of the word and have used this blog in your instructional capacity, please take a couple of minutes to fill out this short survey below (Five questions only, short. Really! short!!) It is important for me to know the extent of BsB’s outreach and […]
