The Genome Center at University of California Davis and researchers at UC Santa Cruz are organizing a genome assembly competition which they call The Assemblathon. They have released two simulated genomes for competing groups to assemble as best they can. Assemblies are due February 6th, 2011. So there is still time, if you would like […]
catgaacgcgaataagcgcgcgaataaagcatggaataaaacatttgcgaataatttattcgcgaatggcgcaaaagc
Nature Genetics seems to have taken a page from the Food Network Magazine by timing two publications to the annual obsession with festive foods among many, NG readership included. I am talking about the genomes of the Strawberry and of the Cocoa plants. Both are important crops, both are components of luxurious eating. Both papers are comprehensive […]
The personal genomics company 23&me is hosting a poetry contest. The winner receives a free pass to the Personalized World Medicine Conference. Poems should include a bunch of keywords having to do with 23&me, personalized genomics and all that jazz. I’m no poet (and don’t you know it), so here is my Haiku non-entry: My genome was seq- […]
cag·ey /ˈkājē/ (adjective) Reluctant to give information owing to caution or suspicion CAGI /ˈkājē/ (acronym) Critical Assessment of Genomic Interpretations. For details keep reading. The ability to sequence one’s genome adds a new dimension to the ancient maxim “know thyself”. What could be more revealing of one’s self than one’s own blueprint, explaining existing […]
So everybody is excited about the new GFAJ-1 bacterium that Felisa Wolfe-Simon and her colleagues have discovered. A common buzzphrase diffusing through the media and blogosphere is “NASA discovers a new life form“. (Or, better yet alien life.) Big press conference, and I just finished going through the article that Wolfe-Simon and colleagues have published in Science. Great […]
Personal genetics companies are fitting in well with the post-Thanksgiving Day consumer frenzy in the US. Well, maybe not so much of a frenzy in this slow economy, more like mild agitation. 23&me are having a sale, your genotype for $99 (+ 1 year subscription, etc, comes out to $159). You can get your genotype, […]
If you entered this post to comment the error in the title, then I have one word for you. Gotcha! Yes, “warm blooded” animals are not, really, warm blooded. After all, a lizard in the baking sun has a core temperature higher than most mammals, but it is still called “cold blooded”. So-called cold blooded […]
I’m at College Station airport, Texas, waiting for my delayed flight and hope that the weather in Dallas lets up within the hour. A good time to take a break and blog. College Station is the home of Texas A&M University, which is a place I am always happy to visit. The scientists here are […]
Yes, it’s that time when we all get together in front of the screen to watch another beautiful game played by that fantastic team contributing to the Carnival of Evolution. This time hosted on the lovely green pitch of Byte Size Biology. So get your popcorn, sunflower-seeds, crisps or any other culturally-appropriate sports-watching food and…… […]
The first article in the Journal of Serendipitous and Unexpected Results (JSUR) has been published. Reminder: “JSUR is an open-access forum for researchers seeking to further scientific discovery by sharing surprising or unexpected results. These results should provide guidance toward the verification (or negation) of extant hypotheses.” (From the JSUR website.) I posted about JSUR before here and […]
It isn’t junk DNA: God just commented out a lot of crappy code as he rolled out releases. — An old bioinformaticians’ joke (Hey, I never said it was a funny joke…) Why are some genomes so big? I mean, seriously. Why would the marbled lungfish with a genome weighing 132.83 picograms (pg) need an […]
The 29th edition of the Carnival of Evolution will be hosted here. There are quite a few good things in store: on parrot feathers and lizardfish eyes, on Darwin cartoons, on dogs, dancing and much more. You can still contribute. So if you are a blogger with a post on evolution, go to the blog […]
Warning: somewhat NSFW language.
This seems very promising: two consecutive workshops on biological Wikis in Naples. If you have a life-science related wiki, plan on doing one, or just want to learn about how collaborative authoring can help your work, this would be a great place to do so. Thanks to Paolo Romano for the information. Joint NETTAB 2010 […]
