So here are EssOh and OhOne assembling a rather frustrating puzzle containing cows. The same 5-6 cow “characters” are repeated, which is a perfect way to illustrate low-complexity DNA sequences, and why they are hard to assemble, especially when the pieces are small, like those you get from some second generation sequencers.
Some time ago an article in Linux Journal discussed the adoption of free/open course software (FOSS) by the general public. The article (I can’t seem to find it now) talked about the people that do not care about the distinction between Free as in Free Beer vs. Free as in Freedom (libre). They want software […]
The Genome Center at University of California Davis and researchers at UC Santa Cruz are organizing a genome assembly competition which they call The Assemblathon. They have released two simulated genomes for competing groups to assemble as best they can. Assemblies are due February 6th, 2011. So there is still time, if you would like […]
catgaacgcgaataagcgcgcgaataaagcatggaataaaacatttgcgaataatttattcgcgaatggcgcaaaagc
Nature Genetics seems to have taken a page from the Food Network Magazine by timing two publications to the annual obsession with festive foods among many, NG readership included. I am talking about the genomes of the Strawberry and of the Cocoa plants. Both are important crops, both are components of luxurious eating. Both papers are comprehensive […]
The personal genomics company 23&me is hosting a poetry contest. The winner receives a free pass to the Personalized World Medicine Conference. Poems should include a bunch of keywords having to do with 23&me, personalized genomics and all that jazz. I’m no poet (and don’t you know it), so here is my Haiku non-entry: My genome was seq- […]
Winter Solstice Lunar Eclipse from William Castleman on Vimeo. Time lapse video of Winter Solstice Lunar Eclipse on December 21, 2010 from 1:10 AM EST (6:10 GMT) to 5:03 AM EST (10:03 GMT) from Gainesville Florida. Music is Claude Debussy Nocturnes: Sirènes.
This came in my inbox today: solicitation to submit manuscripts to a journal completely outside my area of interest and proficiency. My email client software had an interesting reaction to it: The next email in my inbox was this: OK, that’s taking things a bit too far. Random solicitation of editors (did I mention that was not […]
cag·ey /ˈkājē/ (adjective) Reluctant to give information owing to caution or suspicion CAGI /ˈkājē/ (acronym) Critical Assessment of Genomic Interpretations. For details keep reading. The ability to sequence one’s genome adds a new dimension to the ancient maxim “know thyself”. What could be more revealing of one’s self than one’s own blueprint, explaining existing […]
Since its publication, the paper about bacteria using arsenic instead of phosphorous has been criticized from several different angles. First for the media pre-publication stoking, which lead many journalists to speculate about microbes from Titan while the paper was still embargoed (titanic microbes?), when ultimately it was revealed that we are dealing with earthlings, although […]
So everybody is excited about the new GFAJ-1 bacterium that Felisa Wolfe-Simon and her colleagues have discovered. A common buzzphrase diffusing through the media and blogosphere is “NASA discovers a new life form“. (Or, better yet alien life.) Big press conference, and I just finished going through the article that Wolfe-Simon and colleagues have published in Science. Great […]
Iddo: Following an earlier post on the hype cycle of genomic and other technologies, Leighton Pritchard has suggested producing a more elaborate phase diagram of predicted vs. actual usefulness of, uh, stuff. We kicked around the idea back and forth over the weekend, and here’s the result. Over to Leighton, who gets the lion’s share of […]
I received this email today today. I especially appreciate the personal touch in the salutation. Dear Dr. [NAME] Currently, we are involved in organizing “International Conference and Exhibition on Proteomics & Bioinformatics” (Proteomics-2011), will be held during 6–8 June 2011 Hyderabad, India. The main theme of Proteomics-2011 is to “Promote foster & enhances (sic) research […]
Personal genetics companies are fitting in well with the post-Thanksgiving Day consumer frenzy in the US. Well, maybe not so much of a frenzy in this slow economy, more like mild agitation. 23&me are having a sale, your genotype for $99 (+ 1 year subscription, etc, comes out to $159). You can get your genotype, […]
If you entered this post to comment the error in the title, then I have one word for you. Gotcha! Yes, “warm blooded” animals are not, really, warm blooded. After all, a lizard in the baking sun has a core temperature higher than most mammals, but it is still called “cold blooded”. So-called cold blooded […]
