Displaying posts categorized under

Molecular biology

#DNA60

It has not escaped Twitter’s notice that the Watson & Crick paper is 60 years old today . Sorry, too busy to be really creative, so here is a repost from 2009. Think of it as a transposon. Short quiz and a movie for DNA day. 1) We celebrate DNA day because: a) Congress said so [...]

The power of single-cell genomics: the mysterious SR1 bacteria have a unique genetic code

Thanks to Mitch Balish for calling my attention to this one. SR1 bacteria are not exactly a household name, even among microbiologists. They were first discovered in contaminated aquifers,  and since then they were found to be also in animal and insect guts, as well as in human mouths. They are even suspected of being [...]

Crowdsourcing Genomics II: Unveiling HINdeR and Phrux

About this time last year, I posted about a new course I was going to teach, Phage Genomics. Briefly: Phage isolation, electron microscopy, DNA sequencing in the first semester, annotation and comparative genomics in the second. And I get to teach the bioinformatics bit: annotation and comparative genomics. Woo-hoo! The great thing about this course, [...]

Zombie science roundup

  I am fascinated with zombies. Always have been, but even more so since I took an interest in microbiology. The zombie apocalypse is the best known and best chronicled viral infection which hasn’t happened. But it could happen any day, so stock up on non-perishable food, medical supplies, water purification tablets, chainsaws, machetes, baseball [...]

Reverse Translation Discovered?

  We will never look at life at quite the same way again.   Until now, information flow in biology looked like this:   DNA gets transcribed to RNA, wheich in turn is translated to protein. While reverse transcription does take place with retroviruses using reverse transcriptase, the central dogma of molecular biology held that [...]

Why it’s hard to assemble repetitive DNA regions

So here are EssOh and OhOne assembling a rather frustrating puzzle containing cows. The same 5-6 cow “characters” are repeated, which is a perfect way to illustrate low-complexity DNA sequences, and why they are hard to assemble, especially when the pieces are small, like those you get from some second generation sequencers.

catgcgccgccgtattaaaatgaatggtaatatgaagcgcgt

catgaacgcgaataagcgcgcgaataaagcatggaataaaacatttgcgaataatttattcgcgaatggcgcaaaagc

Making genomes less CAGI

cag·ey    /ˈkājē/ (adjective) Reluctant to give information owing to caution or suspicion CAGI /ˈkājē/ (acronym) Critical Assessment of Genomic Interpretations. For details keep reading. The ability to sequence one’s genome adds a new dimension to the ancient maxim “know thyself”. What could be more revealing of one’s self than one’s own blueprint, explaining existing [...]

A new life form? Not so fast

So everybody is excited about the new GFAJ-1 bacterium that Felisa Wolfe-Simon and her colleagues have discovered. A common buzzphrase diffusing through the media and blogosphere is “NASA discovers a new  life form“. (Or, better yet alien life.) Big press conference, and I just finished going through  the article that Wolfe-Simon and colleagues have published in Science. Great [...]

It’s a small (RNA) world after all

The central dogma of molecular biology edit: the sequence hypothesis (thanks for setting me straight, Kamel!) as formulated 57 years ago was simple: DNA is transcribed to mRNA,and  mRNA is translated to proteins. Proteins are the business end of this process. mRNA is only the messenger: its sole function is to deliver information from the [...]